CD48 Recombinant Protein
Datasheet
Catalog Number:
E43CP0213Amount:
500ugSwiss-Prot No.:
P09326Source:
E.coliVector and tag:
His-tagAmino acid sequence:
CAGGGTCATCTGGTTCACATGACCGTTGTGAGCGGTAGCAATGTTACCCTGAATATTAGCGAAAGCCTGCCGGAAAATTATAAACAGCTGACCTGGTTCTATACCTTCGATCAGAAAATTGTGGAATGGGATAGTCGTAAAAGTAAATACTTCGAAAGCAAATTCAAGGGCCGTGTGCGTCTGGATCCGCAGAGCGGCGCCCTGTATATTAGCAAAGTTCAGAAAGAAGATAACAGTACCTATATTATGCGCGTGCTGAAAAAAACCGGTAATGAACAGGAATGGAAAATTAAACTGCAGGTGCTGGATCCGGTGCCGAAACCGGTTATTAAAATTGAAAAAATCGAGGATATGGACGATAATTGTTATCTGAAACTGAGTTGCGTGATTCCGGGTGAAAGCGTTAATTATACCTGGTATGGCGATAAACGTCCGTTCCCGAAAGAACTGCAGAATAGCGTTCTGGAAACCACCCTGATGCCGCATAATTATAGTCGCTGTTATACCTGTCAGGTTAGTAATAGTGTTAGCAGCAAAAATGGTACCGTGTGTCTGAGTCCGCCGTGTACCCTGGCACGTAGTAll Sites:
NdeI-XhoIBackground:
CD48 is a glycosylphosphatidylinositol (GPI) -anchored membrane protein of the signaling lymphocyte activation molecule (SLAM) family, also known as SLAMF2 and BLAST-1. It is constitutively expressed on most hematopoietic cells (not on neutrophils and a subset of long-term hematopoietic stem cells in mice) and can be upregulated under certain conditions like infection. Interaction with its low affinity ligand CD2 promotes adhesion and TCR signaling. Interaction with the high affinity ligand CD244 (2B4) regulates natural killer (NK) and CD8 T cell activation and cytolytic function.Solubility:
PBS, 4M Urea, PH7.4Purification:
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).Storage Stability:
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.Expression Host:
pet-22b(+)MolecularWeight(Da):
~21kDaPrice:
580$
Related Products
Catalog Number
- Amount:500ug
- Price:580$
Contact us
Categories by research area
Categories by product type
- Antibodies
- Tag antibodies
- Internal control antibodies
- Pathological (Immunohistochemistry, IHC) antibodies
- Cell Signal Transduction Research Antibodies
- Secondary Antibody
- Antibody Sampler Kits
- Recombinant Proteins
- Fluorescence Reagents
- Signal Inhibitors and Activators
- Transfection Reagent
- Cell biology kits